Stem-loop sequence dre-mir-338-3

AccessionMI0039524 (change log)
DescriptionDanio rerio miR-338-3 stem-loop
Literature search

4 open access papers mention dre-mir-338-3
(14 sentences)

Stem-loop
   ggug              u   -         ccu    a auc 
5'     ucuccuggcaacaa auc cuggugcug   gagu c   u
       |||||||||||||| ||| |||||||||   |||| |    
3'     agggggccguuguu uag gacuacgac   cuca g   c
   caaa              u   u         ---    - aca 
Get sequence
Deep sequencing
8738 reads, 455 reads per million, 11 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 51907478-51907562 [-]
intergenic
Database links

Mature sequence dre-miR-338-5p

Accession MIMAT0048672
Sequence

14 - 

aacaauauccuggugcugccugagu

 - 38

Get sequence
Deep sequencing35 reads, 7 experiments
Evidence not experimental

Mature sequence dre-miR-338-3p

Accession MIMAT0048673
Sequence

52 - 

uccagcaucagugauuuuguugc

 - 74

Get sequence
Deep sequencing5635 reads, 11 experiments
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).