Stem-loop sequence dre-mir-338-3

AccessionMI0039524 (change log)
DescriptionDanio rerio miR-338-3 stem-loop
Stem-loop
   ggug              u   -         ccu    a auc 
5'     ucuccuggcaacaa auc cuggugcug   gagu c   u
       |||||||||||||| ||| |||||||||   |||| |    
3'     agggggccguuguu uag gacuacgac   cuca g   c
   caaa              u   u         ---    - aca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 51907478-51907562 [-]
intergenic
Database links

Mature sequence dre-miR-338-5p

Accession MIMAT0048672
Sequence

14 - 

aacaauauccuggugcugccugagu

 - 38

Get sequence
Evidence not experimental

Mature sequence dre-miR-338-3p

Accession MIMAT0048673
Sequence

52 - 

uccagcaucagugauuuuguugc

 - 74

Get sequence
Evidence not experimental

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).