Stem-loop sequence mml-mir-328

AccessionMI0039836 (change log)
DescriptionMacaca mulatta miR-328 stem-loop
Literature search

1 open access papers mention mml-mir-328
(14 sentences)

Stem-loop
   --        ga     u     a aaa  g 
5'   gggggcag  ggggc caggg g   gu c
     ||||||||  ||||| ||||| |   ||  
3'   uucccguc  ucccg guccc c   cg a
   cc        uc     -     - -ga  u 
Get sequence
Deep sequencing
146 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 51478395-51478453 [-]
intergenic
Database links

Mature sequence mml-miR-328

Accession MIMAT0049124
Sequence

40 - 

cuggcccucucugcccuucc

 - 59

Get sequence
Deep sequencing139 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).