Stem-loop sequence pha-let-7a-1

AccessionMI0040272 (change log)
DescriptionPapio hamadryas let-7a-1 stem-loop
Literature search

1 open access papers mention pha-let-7a-1
(4 sentences)

Stem-loop
   --u   gu                ---------        
5'    gag  aguagguuguauaguu         uggggcu 
      |||  ||||||||||||||||         |||||| c
3'    uuc  ucaucuaacauaucaa         gucccgu 
   ccu   ug                uaggguauc        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-let-7a

Accession MIMAT0049507
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).