Stem-loop sequence pha-let-7e

AccessionMI0040281 (change log)
DescriptionPapio hamadryas let-7e stem-loop
Literature search

1 open access papers mention pha-let-7e
(4 sentences)

Stem-loop
   --u   g                u  ----gga  a 
5'    gag uaggagguuguauagu ga       gg c
      ||| |||||||||||||||| ||       ||  
3'    uuc auccuccggcauauca cu       cc a
   ccu   g                -  agaggaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-let-7e

Accession MIMAT0049516
Sequence

1 - 

ugagguaggagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).