Stem-loop sequence pha-mir-181b-2

AccessionMI0040284 (change log)
DescriptionPapio hamadryas miR-181b-2 stem-loop
Literature search

1 open access papers mention pha-mir-181b-2
(3 sentences)

Stem-loop
   --aa         cu           u  gu 
5'     cauucauug  gucgguggguu ga  c
       |||||||||  ||||||||||| ||  u
3'     guaaguagc  uagucacucaa cu  g
   aaac         --           -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-181b

Accession MIMAT0049519
Sequence

1 - 

aacauucauugcugucgguggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).