Stem-loop sequence pha-mir-181a-2

AccessionMI0040285 (change log)
DescriptionPapio hamadryas miR-181a-2 stem-loop
Literature search

1 open access papers mention pha-mir-181a-2
(3 sentences)

Stem-loop
   --a   u      cu       a    ggga 
5'    aca ucaacg  gucggug guuu    u
      ||| ||||||  ||||||| ||||    u
3'    ugu aguugc  cagucac caaa    u
   cca   c      --       -    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-181a

Accession MIMAT0049520
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).