Stem-loop sequence pha-let-7a-2

AccessionMI0040287 (change log)
DescriptionPapio hamadryas let-7a-2 stem-loop
Literature search

1 open access papers mention pha-let-7a-2
(4 sentences)

Stem-loop
   --u   g   u             uagaa ua a 
5'    gag uag agguuguauaguu     u  c u
      ||| ||| |||||||||||||     |  | c
3'    uuc auc uccgacaugucaa     a  g a
   ccu   g   c             --uag gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-let-7a

Accession MIMAT0049507
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).