Stem-loop sequence pha-mir-29a

AccessionMI0040303 (change log)
DescriptionPapio hamadryas miR-29a stem-loop
Literature search

1 open access papers mention pha-mir-29a
(1 sentences)

Stem-loop
   --         uuu       c    ucaa 
5'   acugauuuc   ugguguu agag    u
     |||||||||   ||||||| ||||    a
3'   uggcuaaag   accacga ucuu    u
   au         ucu       -    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-29a

Accession MIMAT0049536
Sequence

39 - 

uagcaccaucugaaaucgguua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).