Stem-loop sequence pha-mir-92a-2

AccessionMI0040304 (change log)
DescriptionPapio hamadryas miR-92a-2 stem-loop
Literature search

1 open access papers mention pha-mir-92a-2
(1 sentences)

Stem-loop
   --          c   u           uu 
5'   agguugggau ggu gcaaugcugug  u
     |||||||||| ||| |||||||||||   
3'   uccggcccug uca cguuaugguau  c
   ug          u   -           gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-92a

Accession MIMAT0049537
Sequence

38 - 

uauugcacuugucccggccugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).