Stem-loop sequence pha-mir-16-1

AccessionMI0040323 (change log)
DescriptionPapio hamadryas miR-16-1 stem-loop
Literature search

2 open access papers mention pha-mir-16-1
(3 sentences)

Stem-loop
   --         -  a        c u   gauu 
5'   uagcagcac gu aauauugg g uaa    c
     ||||||||| || |||||||| | |||     
3'   gucgucgug ca uuaugacc c auu    u
   aa         u  a        u u   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-16

Accession MIMAT0049555
Sequence

1 - 

uagcagcacguaaauauuggcg

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).