Stem-loop sequence pha-mir-19b-2

AccessionMI0040325 (change log)
DescriptionPapio hamadryas miR-19b-2 stem-loop
Literature search

1 open access papers mention pha-mir-19b-2
(2 sentences)

Stem-loop
   --        -  -       uuca       u 
5'   guuuugca gg uuugcau    gcguaua a
     |||||||| || |||||||    |||||||  
3'   caaaacgu cc aaacgug    uguauau u
   gu        a  u       ucgg       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-19b

Accession MIMAT0049538
Sequence

43 - 

ugugcaaauccaugcaaaacug

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).