Stem-loop sequence pha-mir-155

AccessionMI0040328 (change log)
DescriptionPapio hamadryas miR-155 stem-loop
Literature search

1 open access papers mention pha-mir-155
(3 sentences)

Stem-loop
   --          u    a        uuuac 
5'   uuaaugcuaa cgug uagggguu     c
     |||||||||| |||| ||||||||     u
3'   aauuacgauu guac auccucag     c
   ac          -    -        ucaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-155

Accession MIMAT0049558
Sequence

1 - 

uuaaugcuaaucgugauaggggu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).