Stem-loop sequence pha-mir-221

AccessionMI0040329 (change log)
DescriptionPapio hamadryas miR-221 stem-loop
Literature search

1 open access papers mention pha-mir-221
(2 sentences)

Stem-loop
   ---   ug   u         auuu    -   c 
5'    acc  gca acaauguag    cugu guu g
      |||  ||| |||||||||    |||| ||| u
3'    ugg  cgu uguuacauc    gaca cgg u
   cuu   gu   c         ----    a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-221

Accession MIMAT0049559
Sequence

41 - 

agcuacauugucugcuggguuuc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).