Stem-loop sequence pha-mir-222

AccessionMI0040330 (change log)
DescriptionPapio hamadryas miR-222 stem-loop
Literature search

1 open access papers mention pha-mir-222
(3 sentences)

Stem-loop
   --              -     auc   ucuu 
5'   ggcucaguagccag uguag   cug    u
     |||||||||||||| |||||   |||    c
3'   cugggucaucgguc acauc   gac    g
   cu              u     gac   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-222

Accession MIMAT0049560
Sequence

41 - 

agcuacaucuggcuacugggucuc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).