Stem-loop sequence pha-mir-21

AccessionMI0040338 (change log)
DescriptionPapio hamadryas miR-21 stem-loop
Literature search

1 open access papers mention pha-mir-21
(2 sentences)

Stem-loop
   -         a     a     a    u a 
5'  uagcuuauc gacug uguug cugu g a
    ||||||||| ||||| ||||| |||| | u
3'  gucggguag cugac acaac ggua c c
   u         -     c     -    - u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-21

Accession MIMAT0049568
Sequence

1 - 

uagcuuaucagacugauguugac

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).