Stem-loop sequence pha-mir-146a

AccessionMI0040344 (change log)
DescriptionPapio hamadryas miR-146a stem-loop
Literature search

3 open access papers mention pha-mir-146a
(7 sentences)

Stem-loop
   --u            c        g  uc 
5'    gagaacugaauu cauggguu ug  a
      |||||||||||| |||||||| ||  g
3'    uucuugacuuaa guguccag ac  u
   gac            a        -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-146a

Accession MIMAT0049573
Sequence

1 - 

ugagaacugaauuccauggguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).