Stem-loop sequence pha-let-7g

AccessionMI0040349 (change log)
DescriptionPapio hamadryas let-7g stem-loop
Literature search

1 open access papers mention pha-let-7g
(4 sentences)

Stem-loop
   --u        a            ugagg    -a  a    a 
5'    gagguagu guuuguacaguu     gucu  ug uacc c
      |||||||| ||||||||||||     ||||  || ||||  
3'    uuccguca cggacaugucaa     uaga  ac augg c
   ccg        c            -----    gg  -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-let-7g

Accession MIMAT0049574
Sequence

1 - 

ugagguaguaguuuguacaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).