Stem-loop sequence pha-mir-210-1

AccessionMI0040350 (change log)
DescriptionPapio hamadryas miR-210-1 stem-loop
Literature search

1 open access papers mention pha-mir-210-1
(1 sentences)

Stem-loop
   --    c   cc   -      c  c -     
5'   agcc cug  cac cgcaca ug g cugc 
     |||| |||  ||| |||||| || | ||| c
3'   ucgg gac  gug gcgugu ac c gacc 
   ag    c   -a   u      c  c a     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-miR-210

Accession MIMAT0049575
Sequence

39 - 

cugugcgugugacagcggcuga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).