Stem-loop sequence pha-let-7c

AccessionMI0040368 (change log)
DescriptionPapio hamadryas let-7c stem-loop
Literature search

1 open access papers mention pha-let-7c
(4 sentences)

Stem-loop
   --u   g   u             ua  g ua a 
5'    gag uag agguuguaugguu  ga u  c c
      ||| ||| |||||||||||||  || |  | c
3'    uuc auc uccaacaugucaa  uu a  g c
   ccu   g   u             --  g gg u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pha-let-7c

Accession MIMAT0049589
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).