Stem-loop sequence mmu-mir-122b

AccessionMI0040634 (change log)
Symbol MGI:Mir122b
DescriptionMus musculus miR-122b stem-loop
Stem-loop
   ---uuu             c     a  gu 
5'       agugugauaaugg guuug ug  u
         ||||||||||||| ||||| ||  u
3'       ucacacuguuacc caaac ac  g
   gacacc             a     -  ag 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 65248863-65248921 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-122b
mmu-mir-122bchr18: 65248863-65248921 [-]
mmu-mir-122chr18: 65248861-65248926 [+]
Database links

Mature sequence mmu-miR-122b-5p

Accession MIMAT0049852
Sequence

1 - 

uuuagugugauaauggcguuug

 - 22

Get sequence
Deep sequencing45 reads, 13 experiments
Evidence experimental; Illumina [1]

Mature sequence mmu-miR-122b-3p

Accession MIMAT0049853
Sequence

36 - 

aaacaccauugucacacuccac

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).