Stem-loop sequence gga-mir-2985-1

AccessionMI0040664 (change log)
DescriptionGallus gallus miR-2985-1 stem-loop
Literature search

1 open access papers mention gga-mir-2985-1
(1 sentences)

Stem-loop
   --gu          g          u 
5'     ggguggaaua uauaacaaua a
       |||||||||| ||||||||||  
3'     uccaccuuau auauuguugu c
   cccu          g          a 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 181232501-181232552 [-]
intergenic
Database links

Mature sequence gga-miR-2985-5p

Accession MIMAT0049898
Sequence

1 - 

guggguggaauaguauaacaau

 - 22

Get sequence
Deep sequencing40 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-2985-3p

Accession MIMAT0049899
Sequence

31 - 

uguuauaguauuccaccuuccc

 - 52

Get sequence
Deep sequencing15 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).