Stem-loop sequence gga-mir-184b

AccessionMI0040669 (change log)
DescriptionGallus gallus miR-184b stem-loop
Stem-loop
   ---        g  c   -     acag  aga 
5'    ccuuauca uu ucc gucca    uc   g
      |||||||| || ||| |||||    ||    
3'    ggaauagu aa agg cgggu    ag   c
   ggg        g  a   u     -cga  aag 
Get sequence
Deep sequencing
202 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 19996779-19996841 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-184b
gga-mir-184bchr10: 19996779-19996841 [-]
gga-mir-184chr10: 19996770-19996843 [+]
Database links

Mature sequence gga-miR-184b-5p

Accession MIMAT0049906
Sequence

1 - 

ccuuaucaguucuccguccaac

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-184b-3p

Accession MIMAT0049907
Sequence

40 - 

ugggcuggaaaagugauaagggg

 - 62

Get sequence
Deep sequencing201 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).