Stem-loop sequence gga-mir-132c

AccessionMI0040695 (change log)
DescriptionGallus gallus miR-132c stem-loop
Literature search

4 open access papers mention gga-mir-132c
(4 sentences)

Stem-loop
   -a   a  a  g         -    uc    cc 
5'   gcc ug cu uagacuguu acug  cugu  c
     ||| || || ||||||||| ||||  ||||   
3'   ugg ac ga aucugacga ugac  gacg  u
   cg   a  c  g         a    --    ca 
Get sequence
Deep sequencing
865 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 5515771-5515836 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-132c
gga-mir-2184bchr19: 5515022-5515080 [-]
gga-mir-2184achr19: 5515026-5515081 [+]
gga-mir-132achr19: 5515203-5515261 [-]
gga-mir-132bchr19: 5515205-5515263 [+]
gga-mir-212chr19: 5515770-5515834 [-]
gga-mir-132cchr19: 5515771-5515836 [+]
Database links

Mature sequence gga-miR-132c-5p

Accession MIMAT0049956
Sequence

1 - 

agccaugacuguagacuguuacu

 - 23

Get sequence
Deep sequencing840 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-132c-3p

Accession MIMAT0049957
Sequence

41 - 

caguaagcagucuagagccaag

 - 62

Get sequence
Deep sequencing25 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).