Stem-loop sequence gga-mir-12242

AccessionMI0040704 (change log)
DescriptionGallus gallus miR-12242 stem-loop
Stem-loop
   -  c      -  -       c     ucucc 
5'  gc gagggg gg guugcgg gcagu     c
    || |||||| || ||||||| |||||      
3'  cg cucuuc cc cgacgcc cgucg     g
   u  -      g  a       -     ucucg 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 8883519-8883579 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-12242
gga-mir-12242chr20: 8883519-8883579 [+]
gga-mir-124a-2chr20: 8883886-8883983 [+]
Database links

Mature sequence gga-miR-12242-5p

Accession MIMAT0049972
Sequence

1 - 

gccgaggggggguugcggcgcagu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gga-miR-12242-3p

Accession MIMAT0049973
Sequence

39 - 

ugcccgcagcaccgcuucucgcu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).