Stem-loop sequence gga-mir-129-1

AccessionMI0040749 (change log)
DescriptionGallus gallus miR-129-1 stem-loop
Literature search

3 open access papers mention gga-mir-129-1
(8 sentences)

Stem-loop
   ----       c   cu      g   uacauaa 
5'     cuuuuug ggu  gggcuu cug       c
       ||||||| |||  |||||| |||        
3'     gaaaaac cca  cccgaa ggc       u
   uuac       c   uu      g   ccaucca 
Get sequence
Deep sequencing
293838 reads, 2.84e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 21516911-21516976 [+]
intergenic
Database links

Mature sequence gga-miR-129-5p

Accession MIMAT0050056
Sequence

1 - 

cuuuuugcggucugggcuugc

 - 21

Get sequence
Deep sequencing832347 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-129-1-3p

Accession MIMAT0050057
Sequence

44 - 

aagcccuuaccccaaaaagcau

 - 65

Get sequence
Deep sequencing16376 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).