Stem-loop sequence gga-let-7l-1

Accession

MI0040762 (change log)

Description

Gallus gallus let-7l-1 stem-loop

Literature search

45 open access papers mention gga-let-7l-1
(220 sentences)

Stem-loop

   --u                      ----------      gg 
5'    gagguagucgguuguauuguug          ggggcc  g
      ||||||||||||||||||||||          ||||||  a
3'    uuucaucagccgacguagcaau          ccccgg  u
   ccc                      ggagcucaca      gg 

Deep sequencing

6521819 reads, 7.69e+04 reads per million, 5 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): AADN04005513.1: 10244-10320 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0040762

Mature sequence gga-let-7l-5p

• Accession: MIMAT0050080
• Sequence: 1 - ugagguagucgguuguauuguu - 22
• Deep sequencing: 13043546 reads, 5 experiments
• Evidence: experimental; Illumina [1]

Mature sequence gga-let-7l-3p

• Accession: MIMAT0050081
• Sequence: 56 - cgaugcagccgacuacuuucc - 76
• Deep sequencing: 90 reads, 4 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).