Stem-loop sequence gga-mir-129-2

AccessionMI0040764 (change log)
DescriptionGallus gallus miR-129-2 stem-loop
Literature search

3 open access papers mention gga-mir-129-2
(8 sentences)

Stem-loop
   ----       c   cu      g   --u  cc 
5'     cuuuuug ggu  gggcuu cug   gc  c
       ||||||| |||  |||||| |||   ||   
3'     gaaaaac cca  cccgaa gac   cg  a
   cuag       c   uu      g   ucu  ac 
Get sequence
Deep sequencing
293824 reads, 2.84e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
AADN04013943.1: 1738-1801 [-]
intergenic
Database links

Mature sequence gga-miR-129-5p

Accession MIMAT0050056
Sequence

1 - 

cuuuuugcggucugggcuugc

 - 21

Get sequence
Deep sequencing832347 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-129-3p

Accession MIMAT0050082
Sequence

42 - 

aagcccuuaccccaaaaaggau

 - 63

Get sequence
Deep sequencing32746 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).