Stem-loop sequence gga-mir-12294

AccessionMI0040775 (change log)
DescriptionGallus gallus miR-12294 stem-loop
Stem-loop
   ---        cagcc       a  a  aga 
5'    ucuucccu     aggcuug cu ca   c
      ||||||||     ||||||| || ||   c
3'    agaaggga     uccgaac ga gu   u
   gga        --ccc       c  -  aac 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 768922-768982 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-12294
gga-mir-122-1chrZ: 761121-761197 [+]
gga-mir-12294chrZ: 768922-768982 [+]
Database links

Mature sequence gga-miR-12294-5p

Accession MIMAT0050094
Sequence

1 - 

ucuucccucagccaggcuugacu

 - 23

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-12294-3p

Accession MIMAT0050095
Sequence

40 - 

ccaagccucccagggaagaagg

 - 61

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).