Stem-loop sequence cel-mir-64

AccessionMI0000035 (change log)
DescriptionCaenorhabditis elegans miR-64 stem-loop
Gene family MIPF0000295; mir-64
Literature search

2 open access papers mention cel-mir-64
(10 sentences)

Stem-loop
   -cucccc    a -  c     a    a      ag   --       -   uuuuc 
5'        gcug c cu gccga uaug cacuga  cgu  uaccgaa ccg     c
          |||| | || ||||| |||| ||||||  |||  ||||||| |||      
3'        ugac g ga cggcu guac gugacu  gca  guggcuu ggu     c
   uaugaau    c c  u     c    g      -a   ac       a   ccaca 
Get sequence
Deep sequencing
2572051 reads, 1.32e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 2172848-2172957 [+]
sense
Y48G9A.3 ; Y48G9A.3; intron 11
Clustered miRNAs
< 10kb from cel-mir-64
cel-mir-229chrIII: 2172452-2172566 [+]
cel-mir-64chrIII: 2172848-2172957 [+]
cel-mir-65chrIII: 2173002-2173101 [+]
cel-mir-66chrIII: 2173108-2173206 [+]
Database links

Mature sequence cel-miR-64-5p

Accession MIMAT0000036
Previous IDscel-miR-64
Sequence

22 - 

uaugacacugaagcguuaccgaa

 - 44

Get sequence
Deep sequencing2571505 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-64-3p

Accession MIMAT0015105
Previous IDscel-miR-64*
Sequence

68 - 

gugcaacgaucaguggcaugc

 - 88

Get sequence
Deep sequencing504 reads, 15 experiments
Evidence experimental; CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).