Stem-loop sequence cel-mir-66

AccessionMI0000037 (change log)
DescriptionCaenorhabditis elegans miR-66 stem-loop
Literature search

3 open access papers mention cel-mir-66
(6 sentences)

Stem-loop
   ------     aaa       aca        a        g    gaauguu 
5'       ccaca   augccau   ugacacug uuagggau ugau       a
         |||||   |||||||   |||||||| |||||||| ||||        
3'       ggugu   ugcggua   acuguggc aauccuua acua       a
   gauguu     --a       caa        -        a    gcccuag 
Get sequence
Deep sequencing
906718 reads, 7.24e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 2173108-2173206 [+]
sense
Y48G9A.3 ; Y48G9A.3; intron 11
Clustered miRNAs
< 10kb from cel-mir-66
cel-mir-229chrIII: 2172452-2172566 [+]
cel-mir-64chrIII: 2172848-2172957 [+]
cel-mir-65chrIII: 2173002-2173101 [+]
cel-mir-66chrIII: 2173108-2173206 [+]
Database links

Mature sequence cel-miR-66-5p

Accession MIMAT0000038
Previous IDscel-miR-66
Sequence

17 - 

caugacacugauuagggauguga

 - 39

Get sequence
Deep sequencing906083 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence cel-miR-66-3p

Accession MIMAT0020315
Previous IDscel-miR-66*
Sequence

60 - 

aaauuccuaacggugucaaac

 - 80

Get sequence
Deep sequencing592 reads, 15 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5