Accession | MIMAT0000099 |
Description | hsa-miR-101-3p mature miRNA |
Hairpins | |
Sequence | UACAGUACUGUGAUAACUGAA |
Evidence |
experimental
cloned [1-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23554480 | has_input UniProtKB:O00501 |
acts_upstream_of | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26022377 | occurs_in CL:0000576 |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26022377 | occurs_in CL:0000576 |
acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26022377 | occurs_in CL:0000576 |
acts_upstream_of | GO:0043433 negative regulation of DNA-binding transcription factor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30692230 | has_input UniProtKB:O60315 |
acts_upstream_of | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31934175 | occurs_in CL:0002618 |
acts_upstream_of | GO:0060354 negative regulation of cell adhesion molecule production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23554480 | has_input UniProtKB:O00501 |
acts_upstream_of | GO:1901343 negative regulation of vasculature development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27693460 | |
acts_upstream_of | GO:2000353 positive regulation of endothelial cell apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31934175 | occurs_in CL:0002618 |
acts_upstream_of_or_within | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31934175 | has_input UniProtKB:O43521 |
acts_upstream_of_or_within | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31934175 | has_input UniProtKB:Q07812 |
acts_upstream_of_or_within | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31934175 | has_input UniProtKB:Q92934 |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31934175 | has_input UniProtKB:P10415 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24592211 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30692230 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20829195 | has_input UniProtKB:Q07820 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21172309 | has_input UniProtKB:P05067 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23554480 | has_input UniProtKB:P33151 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24592211 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24844779 | has_input UniProtKB:Q13618 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25910754 | has_input UniProtKB:Q13546 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26022377 | has_input UniProtKB:O60603 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27693460 | has_input UniProtKB:P33151 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27693460 | has_input UniProtKB:P36897 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27693460 | has_input UniProtKB:P48061 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|