![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-141 |
||||||
Accession | MI0000166 (change log) | |||||
Symbol | MGI:Mir141 | |||||
Description | Mus musculus miR-141 stem-loop | |||||
Gene family | MIPF0000019; mir-8 | |||||
Literature search |
![]()
128 open access papers mention mmu-mir-141 | |||||
Stem-loop |
u -- u au gaa 5' ggg ccaucuu ccag gcaguguugg gguu g ||| ||||||| |||| |||||||||| |||| u 3' ccc gguagaa gguc ugucacaauc ucga a - au - -c agu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-141-5p |
|
Accession | MIMAT0004533 |
Previous IDs | mmu-miR-141* |
Sequence |
6 - caucuuccagugcaguguugga - 27 |
Deep sequencing | 1032 reads, 57 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-141-3p |
|
Accession | MIMAT0000153 |
Previous IDs | mmu-miR-141 |
Sequence |
48 - uaacacugucugguaaagaugg - 69 |
Deep sequencing | 190380 reads, 99 experiments |
Evidence | experimental; cloned [1,3-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|