Stem-loop sequence cel-mir-229

AccessionMI0000304 (change log)
DescriptionCaenorhabditis elegans miR-229 stem-loop
Literature search

3 open access papers mention cel-mir-229
(11 sentences)

Stem-loop
          a        g u        cca    ggaaugccccccauugauuuuuuc 
5' cgccggc augacacu g uaucuuuu   ucgu                        c
   ||||||| |||||||| | ||||||||   ||||                         
3' gcggccg uacugugg c auggaaag   agca                        c
          a        g u        ---    aagguuaaaaaaggggggcuuuuc 
Get sequence
Deep sequencing
133092 reads, 2.08e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 2172452-2172566 [+]
sense
Y48G9A.3 ; Y48G9A.3; intron 11
Clustered miRNAs
< 10kb from cel-mir-229
cel-mir-229chrIII: 2172452-2172566 [+]
cel-mir-64chrIII: 2172848-2172957 [+]
cel-mir-65chrIII: 2173002-2173101 [+]
cel-mir-66chrIII: 2173108-2173206 [+]
Database links

Mature sequence cel-miR-229-5p

Accession MIMAT0000284
Previous IDscel-miR-229
Sequence

8 - 

aaugacacugguuaucuuuuccaucg

 - 33

Get sequence
Deep sequencing51771 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

Mature sequence cel-miR-229-3p

Accession MIMAT0015112
Previous IDscel-miR-229*
Sequence

88 - 

agaaagguaucgggugucauag

 - 109

Get sequence
Deep sequencing81303 reads, 17 experiments
Evidence experimental; CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).