Stem-loop sequence cel-mir-235

AccessionMI0000310 (change log)
DescriptionCaenorhabditis elegans miR-235 stem-loop
Gene family MIPF0000367; mir-235
Literature search

2 open access papers mention cel-mir-235
(5 sentences)

Stem-loop
   -u  gaagaua    g        uu  cu  u     a   ----g   a 
5'   cc       ucag aucaggcc  gg  ga ugcaa auu     uuc c
     ||       |||| ||||||||  ||  || ||||| |||     ||| c
3'   gg       aguc uaguccgg  cc  cu acguu uaa     aag g
   gc  -aaugag    -        -c  cu  c     a   auuaa   u 
Get sequence
Deep sequencing
180106 reads, 694 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 6162291-6162387 [-]
intergenic
Database links

Mature sequence cel-miR-235-5p

Accession MIMAT0020331
Previous IDscel-miR-235*
Sequence

19 - 

aggccuuggcugauugcaaaauu

 - 41

Get sequence
Deep sequencing297 reads, 15 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-235-3p

Accession MIMAT0000290
Previous IDscel-miR-235
Sequence

61 - 

uauugcacucuccccggccuga

 - 82

Get sequence
Deep sequencing179804 reads, 17 experiments
Evidence experimental; cloned [1], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6