Accession | MIMAT0000397 |
Description | dme-miR-125-5p mature miRNA |
Hairpins | |
Sequence | UCCCUGAGACCCUAACUUGUGA |
Evidence |
experimental
Northern [1-2], 454 [3-4], Illumina [4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of_positive_effect | GO:0008340 determination of adult lifespan |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27508495 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22814608 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27508495 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22814608 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27508495 | |
involved_in | GO:0061771 response to caloric restriction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:34100717 |