Stem-loop sequence dme-mir-311

AccessionMI0000423 (change log)
DescriptionDrosophila melanogaster miR-311 stem-loop
Gene family MIPF0000566; mir-310
Literature search

7 open access papers mention dme-mir-311
(24 sentences)

Stem-loop
      a   cau       -a    au   g  u     -   au 
5' ucu gau   uuuucgg  cggu  aug gu aauau uuc  u
   ||| |||   |||||||  ||||  ||| || ||||| |||  u
3' aga cua   aaaaguc  gcca  uac cg uuaua aag  g
      a   --u       cg    cu   a  -     u   cu 
Get sequence
Deep sequencing
181255 reads, 1.58e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20583877-20583960 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-311
dme-mir-992chr2R: 20585314-20585405 [-]
dme-mir-991chr2R: 20585200-20585295 [-]
dme-mir-2498chr2R: 20584709-20584820 [-]
dme-mir-313chr2R: 20584190-20584260 [-]
dme-mir-312chr2R: 20584056-20584121 [-]
dme-mir-311chr2R: 20583877-20583960 [-]
dme-mir-310chr2R: 20583752-20583840 [-]
Database links

Mature sequence dme-miR-311-5p

Accession MIMAT0020837
Sequence

15 - 

cggacgguauauggguuaauauu

 - 37

Get sequence
Deep sequencing3064 reads, 37 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-311-3p

Accession MIMAT0000403
Previous IDsdme-miR-311
Sequence

52 - 

uauugcacauucaccggccuga

 - 73

Get sequence
Deep sequencing178175 reads, 48 experiments
Evidence experimental; cloned [1], Northern [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).