Stem-loop sequence dme-mir-312

AccessionMI0000424 (change log)
DescriptionDrosophila melanogaster miR-312 stem-loop
Gene family MIPF0000573; mir-312
Literature search

10 open access papers mention dme-mir-312
(59 sentences)

Stem-loop
       u   u    a    g     u   cauu 
5' gauu ggu cguc caag gcaau cug    u
   |||| ||| |||| |||| ||||| |||    u
3' uuag ccg gcag guuc cguua gau    u
       u   -    a    a     u   caau 
Get sequence
Deep sequencing
535989 reads, 3.71e+03 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 20584056-20584121 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-312
dme-mir-992chr2R: 20585314-20585405 [-]
dme-mir-991chr2R: 20585200-20585295 [-]
dme-mir-2498chr2R: 20584709-20584820 [-]
dme-mir-313chr2R: 20584190-20584260 [-]
dme-mir-312chr2R: 20584056-20584121 [-]
dme-mir-311chr2R: 20583877-20583960 [-]
dme-mir-310chr2R: 20583752-20583840 [-]
Database links

Mature sequence dme-miR-312-5p

Accession MIMAT0020838
Sequence

5 - 

ugguucgucacaagggcaauucu

 - 27

Get sequence
Deep sequencing3768 reads, 41 experiments
Evidence not experimental
Database links

Mature sequence dme-miR-312-3p

Accession MIMAT0000404
Previous IDsdme-miR-312
Sequence

43 - 

uauugcacuugagacggccuga

 - 64

Get sequence
Deep sequencing532219 reads, 49 experiments
Evidence experimental; cloned [1], Northern [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).