![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-200a |
||||||||
Accession | MI0000554 (change log) | |||||||
Symbol | MGI:Mir200a | |||||||
Description | Mus musculus miR-200a stem-loop | |||||||
Gene family | MIPF0000019; mir-8 | |||||||
Literature search |
![]()
294 open access papers mention mmu-mir-200a | |||||||
Stem-loop |
c - c g - c uu uu 5' uggg c ucu ugggcauc uuaccggacagug ugga uc g |||| | ||| |||||||| ||||||||||||| |||| || g 3' accc g gga acuuguag aauggucugucac aucu ag c c a u a c a -c uu |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-200a-5p |
|
Accession | MIMAT0004619 |
Previous IDs | mmu-miR-200a* |
Sequence |
16 - caucuuaccggacagugcugga - 37 |
Deep sequencing | 3965 reads, 71 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-200a-3p |
|
Accession | MIMAT0000519 |
Previous IDs | mmu-miR-200a |
Sequence |
54 - uaacacugucugguaacgaugu - 75 |
Deep sequencing | 256138 reads, 99 experiments |
Evidence | experimental; cloned [1-2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|