Accession | MIMAT0000536 |
Description | mmu-miR-29c-3p mature miRNA |
Hairpins | |
Sequence | UAGCACCAUUUGAAAUCGGUUA |
Evidence |
experimental
cloned [1-3], Illumina [4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1902430 negative regulation of amyloid-beta formation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21565331 | occurs_in UBERON:0001851 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21565331 | has_input UniProtKB:P56818 |