Accession | MIMAT0000665 |
Description | mmu-miR-223-3p mature miRNA |
Hairpins | |
Sequence | UGUCAGUUUGUCAAAUACCCCA |
Evidence |
experimental
cloned [3], Illumina [4-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24084739 | has_input UniProtKB:P08505 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26526992 | has_input UniProtKB:P28033 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30208760 | has_input UniProtKB:Q8C0J2 |
involved_in | GO:0010507 negative regulation of autophagy |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30208760 | occurs_in CL:0000129 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24084739 | has_input UniProtKB:P08505 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30208760 | has_input UniProtKB:Q8C0J2 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26526992 | has_input UniProtKB:P28033 |
involved_in | GO:0042742 defense response to bacterium |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24084739 | |
involved_in | GO:0045649 regulation of macrophage differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26526992 | occurs_in UBERON:0002371 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26526992 | occurs_in UBERON:0001155 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27502281 | occurs_in UBERON:0002349 |
involved_in | GO:0060546 negative regulation of necroptotic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:27502281 | occurs_in UBERON:0002349 |
involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30208760 | occurs_in CL:0000129 |
involved_in | GO:0090024 negative regulation of neutrophil chemotaxis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24084739 | |
involved_in | GO:1901223 negative regulation of non-canonical NF-kappaB signal transduction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24084739 | |
involved_in | GO:1903980 positive regulation of microglial cell activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30208760 | |
involved_in | GO:2001198 regulation of dendritic cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26526992 | occurs_in UBERON:0002371 |
located_in | GO:0048471 perinuclear region of cytoplasm |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20080987 | part_of CL:0000746 |