![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-200a |
||||||||
Accession | MI0000737 (change log) | |||||||
Symbol | HGNC:MIR200A | |||||||
Description | Homo sapiens miR-200a stem-loop | |||||||
Gene family | MIPF0000019; mir-8 | |||||||
Literature search |
![]()
692 open access papers mention hsa-mir-200a | |||||||
Stem-loop |
c - c g - ----------- a 5' cggg c ccu ugagcauc uuaccggacagu gcugg u |||| | ||| |||||||| |||||||||||| ||||| u 3' gccc g gga acuuguag aauggucuguca cgacc u c a u a c caaucucaguu c |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
miR-200a was cloned from mouse kidney tissue [1], and expression later confirmed by cloning in human [3]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-200a-5p |
|
Accession | MIMAT0001620 |
Previous IDs | hsa-miR-200a* |
Sequence |
16 - caucuuaccggacagugcugga - 37 |
Deep sequencing | 16269 reads, 114 experiments |
Evidence | experimental; cloned [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-200a-3p |
|
Accession | MIMAT0000682 |
Previous IDs | hsa-miR-200a |
Sequence |
54 - uaacacugucugguaacgaugu - 75 |
Deep sequencing | 1200448 reads, 153 experiments |
Evidence | experimental; cloned [3-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|