Accession | MIMAT0000684 |
Description | hsa-miR-302a-3p mature miRNA |
Hairpins | |
Sequence | UAAGUGCUUCCAUGUUUUGGUGA |
Evidence |
experimental
cloned [2,4], Northern [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0002719 negative regulation of cytokine production involved in immune response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29046356 | occurs_in CL:2000001 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22736612 | occurs_in CL:0002322 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25524771 | has_input UniProtKB:O95477 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29046356 | has_input UniProtKB:Q13568 |
involved_in | GO:0010983 positive regulation of high-density lipoprotein particle clearance |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25524771 | occurs_in UBERON:0002107 |
involved_in | GO:0030857 negative regulation of epithelial cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22736612 | occurs_in CL:0002322 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22736612 | occurs_in CL:0002322 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25524771 | has_input UniProtKB:O95477 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29046356 | has_input UniProtKB:Q13568 |
involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25524771 | occurs_in CL:0000235 |
involved_in | GO:0071404 cellular response to low-density lipoprotein particle stimulus |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25524771 | occurs_in CL:0000235 |
involved_in | GO:0090370 negative regulation of cholesterol efflux |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25524771 | occurs_in CL:0000235 |
involved_in | GO:0098586 cellular response to virus |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29046356 | occurs_in CL:2000001 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|