Stem-loop sequence cel-mir-392

AccessionMI0000819 (change log)
DescriptionCaenorhabditis elegans miR-392 stem-loop
Gene family MIPF0000372; mir-392
Stem-loop
   uuuuugaaaauc       cgugu  a    g   u         g      gaaca 
5'             ucgcaga     uc guca cau cgugguuga gauauc     c
               |||||||     || |||| ||| ||||||||| ||||||     a
3'             agcgucu     ag cagu gug gcacuagcu cuauag     a
   -----gacaauc       --uuu  a    a   u         a      aaaaa 
Get sequence
Deep sequencing
308 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The 5' end of the mature sequence was mapped by PCR, and the 3' end confirmed later [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 13597231-13597340 [+]
intergenic
Database links

Mature sequence cel-miR-392-5p

Accession MIMAT0020344
Previous IDscel-miR-392*
Sequence

31 - 

agcauucgugguugaggauau

 - 51

Get sequence
Deep sequencing185 reads, 12 experiments
Evidence experimental; Illumina [4]
Database links

Mature sequence cel-miR-392-3p

Accession MIMAT0000768
Previous IDscel-miR-392
Sequence

68 - 

uaucaucgaucacgugugauga

 - 89

Get sequence
Deep sequencing120 reads, 11 experiments
Evidence experimental; cloned [1-2], PCR [1], Illumina [3-4]
Database links
Predicted targets

References

1
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4