Stem-loop sequence rno-mir-142

Accession

MI0000915 (change log)

Description

Rattus norvegicus miR-142 stem-loop

Gene family

MIPF0000084; mir-142

Literature search

36 open access papers mention rno-mir-142
(218 sentences)

Stem-loop

   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   g        g   a           c         -ug ga g 

Deep sequencing

906929 reads, 1.15e+03 reads per million, 495 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr10: 75050839-75050925 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000053756 ; Mir142-201; exon 1

Database links

• EntrezGene:Mir142
• miRBase Tracker:MI0000915

Mature sequence rno-miR-142-5p

• Accession: MIMAT0000847
• Sequence: 16 - cauaaaguagaaagcacuacu - 36
• Deep sequencing: 817274 reads, 495 experiments
• Evidence: experimental; cloned [2-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-142-5p
  • miRDB:rno-miR-142-5p
  • microrna.org:rno-miR-142-5p

Mature sequence rno-miR-142-3p

• Accession: MIMAT0000848
• Sequence: 52 - uguaguguuuccuacuuuaugga - 74
• Deep sequencing: 89643 reads, 488 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-142-3p
  • miRDB:rno-miR-142-3p
  • microrna.org:rno-miR-142-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).