Stem-loop sequence gga-mir-142

Accession

MI0001281 (change log)

Description

Gallus gallus miR-142 stem-loop

Gene family

MIPF0000084; mir-142

Literature search

8 open access papers mention gga-mir-142
(35 sentences)

Stem-loop

   g        g   c           a         u aa a    
5'  acagugca uca ccauaaaguag aagcacuac a  c gca 
    |||||||| ||| ||||||||||| ||||||||| |  | || c
3'  ugucaugu agu gguauuucauc uuugugaug u  g cgu 
   g        g   a           c         - gg a    

Deep sequencing

111199 reads, 1.18e+03 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr19: 510413-510500 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:
• RNAcentral:URS000075D098_9031
• miRBase Tracker:MI0001281

Mature sequence gga-miR-142-5p

• Accession: MIMAT0001193
• Sequence: 14 - cccauaaaguagaaagcacuac - 35
• Deep sequencing: 9513 reads, 5 experiments
• Evidence: experimental; cloned [2-3], Northern [2]
• Database links:
  • RNAcentral:URS000075E62A_9031
• Predicted targets:
  • TargetScanVert:gga-miR-142-5p
  • miRDB:gga-miR-142-5p

Mature sequence gga-miR-142-3p

• Accession: MIMAT0001194
• Sequence: 53 - uguaguguuuccuacuuuaugg - 74
• Deep sequencing: 101677 reads, 5 experiments
• Evidence: experimental; cloned [2-3]
• Database links:
  • RNAcentral:URS00003395CB_9031
• Predicted targets:
  • TargetScanVert:gga-miR-142-3p
  • miRDB:gga-miR-142-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4. " McBride D, Carre W, Law A, Clinton M Unpublished.
5. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).