![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-142 |
|||||
Accession | MI0001281 (change log) | ||||
Description | Gallus gallus miR-142 stem-loop | ||||
Gene family | MIPF0000084; mir-142 | ||||
Literature search |
![]()
8 open access papers mention gga-mir-142 | ||||
Stem-loop |
g g c a u aa a 5' acagugca uca ccauaaaguag aagcacuac a c gca |||||||| ||| ||||||||||| ||||||||| | | || c 3' ugucaugu agu gguauuucauc uuugugaug u g cgu g g a c - gg a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gga-miR-142-5p |
|
Accession | MIMAT0001193 |
Sequence |
14 - cccauaaaguagaaagcacuac - 35 |
Deep sequencing | 9513 reads, 5 experiments |
Evidence | experimental; cloned [2-3], Northern [2] |
Database links |
|
Predicted targets |
|
Mature sequence gga-miR-142-3p |
|
Accession | MIMAT0001194 |
Sequence |
53 - uguaguguuuccuacuuuaugg - 74 |
Deep sequencing | 101677 reads, 5 experiments |
Evidence | experimental; cloned [2-3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15592404
"Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
Nature. 432:695-716(2004).
|
2 |
PMID:16750530
"Identification of microRNAs from different tissues of chicken embryo and adult chicken"
FEBS Lett. 580:3610-3616(2006).
|
3 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
4 |
"
Unpublished.
|
5 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|