Stem-loop sequence dps-mir-92b

AccessionMI0001321 (change log)
DescriptionDrosophila pseudoobscura miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ---uaaaa  u   -  ga         u c c     uu      c   gu 
5'         cg cac cu  uguaggccg g c agugc  auuugu guu  u
           || ||| ||  ||||||||| | | |||||  |||||| |||  u
3'         gc gug ga  acguccggc c g ucacg  uaaaca uaa  g
   caacacac  u   a  -g         c u a     -u      -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 23630760-23630859 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-92b
dps-mir-92a2: 23635276-23635369 [-]
dps-mir-92b2: 23630760-23630859 [-]
Database links

Mature sequence dps-miR-92b

Accession MIMAT0001227
Sequence

60 - 

aauugcacuagucccggccugc

 - 81

Get sequence
Evidence by similarity; MI0000379, MI0000379