Stem-loop sequence dps-mir-305

AccessionMI0001350 (change log)
DescriptionDrosophila pseudoobscura miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
        cu u         u  g     cu  u  guc 
5' caugu  a uguacuuca ca gugcu  gg gu   c
   |||||  | ||||||||| || |||||  || ||    
3' guaua  u acaugaagu gu cacgg  cc ca   u
        ac c         u  a     --  -  aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
4_group1: 4175887-4175959 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-305
dps-mir-2754_group1: 4175738-4175827 [+]
dps-mir-3054_group1: 4175887-4175959 [+]
Database links

Mature sequence dps-miR-305

Accession MIMAT0001255
Sequence

8 - 

auuguacuucaucaggugcucug

 - 30

Get sequence
Evidence by similarity; MI0000412, MI0000412