Stem-loop sequence cbr-mir-64a

AccessionMI0001392 (change log)
Previous IDscbr-mir-64
DescriptionCaenorhabditis briggsae miR-64 stem-loop
Stem-loop
   u    aau  uc   -       -ac    a   uga    u u     u  aaag 
5'  caag   cc  ggc cucgccg   caug cac   agcg g acgga gg    u
    ||||   ||  ||| |||||||   |||| |||   |||| | ||||| ||     
3'  guuu   gg  ccg gagcggc   guac gug   ucgc c ugccu cc    u
   -    cac  uu   u       aac    c   uga    - u     u  gaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae. The mature sequence differs from the elegans sequence at 3 positions.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 869205-869314 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-64a
cbr-mir-2226chrIII: 869446-869544 [-]
cbr-mir-64cchrIII: 869360-869420 [-]
cbr-mir-64achrIII: 869205-869314 [-]
cbr-mir-64bchrIII: 869080-869196 [-]
cbr-mir-65chrIII: 868808-868904 [-]
Database links

Mature sequence cbr-miR-64a

Accession MIMAT0001292
Previous IDscbr-miR-64
Sequence

25 - 

caugacacugaagcguguacgga

 - 47

Get sequence
Evidence by similarity; MI0000035

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).