Stem-loop sequence ame-mir-125

AccessionMI0001578 (change log)
DescriptionApis mellifera miR-125 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention ame-mir-125
(4 sentences)

Stem-loop
        --  cu  - g          c  cu    cc   a       --c    c 
5' guaaa  gc  gc c cgucgccggu cc  gaga  cua cuuguga   gucg g
   |||||  ||  || | |||||||||| ||  ||||  ||| |||||||   ||||  
3' cguuu  cg  cg g guagcgguua gg  cucu  gau ggacacu   uagc a
        uc  -u  u a          u  -u    ua   c       cua    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000061.5: 8437175-8437281 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-125
ame-mir-100CM000061.5: 8436007-8436106 [+]
ame-let-7CM000061.5: 8436647-8436746 [+]
ame-mir-125CM000061.5: 8437175-8437281 [+]
Database links

Mature sequence ame-miR-125-5p

Accession MIMAT0001474
Sequence

24 - 

ccccugagacccuaacuuguga

 - 45

Get sequence
Evidence experimental; array [1], RTPCR [2], Illumina [3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).