Accession | MIMAT0001788 |
Description | dre-miR-22a-3p mature miRNA |
Hairpins | |
Sequence | AAGCUGCCAGCUGAAGAACUGU |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28112401 | occurs_in UBERON:0000922 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28112401 | has_input UniProtKB:F1R2I9 |